You do not have permission to edit this page, for the following reasons:

This IP address has been blocked from editing Wikipedia.
This does not affect your ability to read Wikipedia pages.
Most people who see this message have done nothing wrong. Some kinds of blocks restrict editing from specific service providers or telecom companies in response to recent abuse or vandalism, and can sometimes affect other users who are unrelated to that abuse. Review the information below for assistance if you do not believe that you have done anything wrong.

The IP address or range 54.234.0.0/16 has been blocked (disabled) by ‪JJMC89‬ for the following reason(s):

The IP address that you are currently using has been blocked because it is believed to be a web host provider or colocation provider. To prevent abuse, web hosts and colocation providers may be blocked from editing Wikipedia.
You will not be able to edit Wikipedia using a web host or colocation provider because it hides your IP address, much like a proxy or VPN.
We recommend that you attempt to use another connection to edit. For example, if you use a proxy or VPN to connect to the internet, turn it off when editing Wikipedia. If you edit using a mobile connection, try using a Wi-Fi connection, and vice versa. If you are using a corporate internet connection, switch to a different Wi-Fi network. If you have a Wikipedia account, please log in.
If you do not have any other way to edit Wikipedia, you will need to request an IP block exemption.

How to appeal if you are confident that your connection does not use a colocation provider's IP address:
If you are confident that you are not using a web host, you may appeal this block by adding the following text on your talk page: ((unblock|reason=Caught by a colocation web host block but this host or IP is not a web host. My IP address is _______. Place any further information here. ~~~~)). You must fill in the blank with your IP address for this block to be investigated. Your IP address can be determined here. Alternatively, if you wish to keep your IP address private you can use the unblock ticket request system. There are several reasons you might be editing using the IP address of a web host or colocation provider (such as if you are using VPN software or a business network); please use this method of appeal only if you think your IP address is in fact not a web host or colocation provider.

Administrators: The IP block exemption user right should only be applied to allow users to edit using web host in exceptional circumstances, and requests should usually be directed to the functionaries team via email. If you intend to give the IPBE user right, a CheckUser needs to take a look at the account. This can be requested most easily at SPI Quick Checkuser Requests. Unblocking an IP or IP range with this template is highly discouraged without at least contacting the blocking administrator.

This block will expire on 05:36, 2 January 2025.

Even when blocked, you will usually still be able to edit your user talk page, as well as email administrators and other editors.

For information on how to proceed, please read the FAQ for blocked users and the guideline on block appeals. The guide to appealing blocks may also be helpful.

Other useful links: Blocking policy · Help:I have been blocked
Your IP address is in a range that has been blocked on all Wikimedia Foundation wikis. The block was made by ‪Jon Kolbert‬. The reason given is Open proxy/Webhost: See the help page if you are affected .
- Start of block: 05:40, 21 February 2024
- Expiry of block: 05:40, 21 February 2029
Your current IP address is 54.234.187.160. The blocked range is 54.234.0.0/16. Please include all above details in any queries you make. If you believe you were blocked by mistake, you can find additional information and instructions in the No open proxies global policy. Otherwise, to discuss the block please post a request for review on Meta-Wiki. You could also send an email to the stewards VRT queue at stewards@wikimedia.org including all above details.

You can view and copy the source of this page:

((Short description|Ends of DNA molecules))
((More citations needed|date=February 2017))

'''DNA ends''' refer to the properties of the ends of linear [[DNA]] molecules, which in [[molecular biology]] are described as "sticky" or "blunt" based on the shape of the complementary strands at the terminus. In '''sticky ends''', one strand is longer than the other (typically by at least a few nucleotides), such that the longer strand has bases which are left unpaired. In '''blunt ends''', both strands are of equal length – i.e. they end at the same base position, leaving no unpaired bases on either strand.

The concept is used in [[molecular biology]], in [[Clone (genetics)|cloning]], or when subcloning [[insert (molecular biology)|insert DNA]] into [[vector (molecular biology)|vector DNA]]. Such ends may be generated by [[restriction enzyme]]s that break the molecule's phosphodiester backbone at specific locations, which themselves belong to a larger class of enzymes called '''exonucleases''' and '''endonucleases'''. A restriction enzyme that cuts the backbones of both strands at non-adjacent locations leaves a staggered cut, generating two overlapping sticky ends, while an enzyme that makes a straight cut (at locations directly across from each other on both strands) generates two blunt ends.<ref>((Cite book|title=Ball|last=Sullivan, Mary |date=17 May 2016 |publisher=Houghton Mifflin Harcourt Publishing Company |isbn=9780544819016|oclc=949423125))</ref>

== Single-stranded DNA molecules ==

A single-stranded non-circular DNA molecule has two non-identical ends, [[Directionality (molecular biology)|the 3' end and the 5' end]] (usually pronounced "three prime end" and "five prime end").  The numbers refer to the numbering of carbon atoms in the [[deoxyribose]], which is a sugar forming an important part of the backbone of the DNA molecule. In the backbone of DNA the 5' carbon of one deoxyribose is linked to the 3' carbon of another by a phosphodiester bond linkage. The 5' carbon of this deoxyribose is again linked to the 3' carbon of the next, and so forth.

== Variations in double-stranded molecules ==

When a molecule of DNA is double stranded, as DNA usually is, the two strands run in opposite directions. Therefore, one end of the molecule will have the 3' end of strand 1 and the 5' end of strand 2, and vice versa in the other end. However, the fact that the molecule is two stranded allows numerous different variations.

===Blunt ends===
The simplest DNA end of a double stranded molecule is called a ''blunt end''. Blunt ends are also known as non-cohesive ends. In a blunt-ended molecule, both strands terminate in a [[base pair]]. Blunt ends are not always desired in biotechnology since when using a [[DNA ligase]] to join two molecules into one, the yield is significantly lower with blunt ends. When performing subcloning, it also has the disadvantage of potentially inserting the insert DNA in the opposite orientation desired. On the other hand, blunt ends are always compatible with each other. Here is an example of a small piece of blunt-ended DNA:

 5'-<span style="color:red;">GATCTGACTGATGCGTATGCTAGT</span>-3'
 3'-<span style="color:red;">CTAGACTGACTACGCATACGATCA</span>-5'

===Overhangs and sticky ends===
Non-blunt ends are created by various ''overhangs''. An overhang is a stretch of unpaired [[nucleotide]]s in the end of a DNA molecule. These unpaired nucleotides can be in either strand, creating either 3' or 5' overhangs. These overhangs are in most cases palindromic.

The simplest case of an overhang is a single nucleotide. This is most often [[adenine]] and is created as a 3' overhang by some [[DNA polymerase]]s. Most commonly this is used in cloning [[Polymerase chain reaction|PCR]] products created by such an enzyme. The product is joined with a linear DNA molecule with a 3' [[thymine]] overhang. Since adenine and thymine form a [[base pair]], this facilitates the joining of the two molecules by a ligase, yielding a circular molecule. Here is an example of an A-overhang:

 5'-<span style="color:red;">ATCTGACTA</span>-3'
 3'-<span style="color:red;">TAGACTGA</span> -5'

Longer overhangs are called ''cohesive ends'' or ''sticky ends''. They are most often created by [[restriction endonucleases]] when they cut DNA. Very often they cut the two DNA strands four base pairs from each other, creating a four-base 3' overhang in one molecule and a complementary 3' overhang in the other. These ends are called cohesive since they are easily joined back together by a ligase.

For example, these two "sticky" ends are compatible:

 5'-<span style="color:red;">ATCTGACT</span>        <span style="color:blue;">GATGCGTATGCT</span>-3'
 3'-<span style="color:red;">TAGACTGACTACG</span>        <span style="color:blue;">CATACGA</span>-5'

Also, since different restriction endonucleases usually create different overhangs, it is possible to create a plasmid by excising a piece of DNA (using a different enzyme for each end) and then joining it to another DNA molecule with ends trimmed by the same enzymes. Since the overhangs have to be complementary in order for the ligase to work, the two molecules can only join in one orientation. This is often highly desirable in [[molecular biology]].

===Frayed ends===

Across from each single strand of DNA, we typically see [[adenine]] pair with [[thymine]], and [[cytosine]] pair with [[guanine]] to form a parallel complementary strand as described below.  Two nucleotide sequences which correspond to each other in this manner are referred to as complementary:

 5'-<span style="color:red;">ATCTGACT</span>-3'
 3'-<span style="color:red;">TAGACTGA</span>-5'

[[Image:Frayed-dna.png|right]]

A frayed end refers to a region of a double stranded (or other multi-stranded) DNA molecule near the end with a significant proportion of non-complementary sequences; that is, a sequence where nucleotides on the adjacent strands do not match up correctly:

 5'-<span style="color:red;">ATCTGACTAGGCA</span>-3'
 3'-<span style="color:red;">TAGACTGA</span><span style="color:green;">CTACG</span>-5'

The term "frayed" is used because the incorrectly matched nucleotides tend to avoid bonding, thus appearing similar to the strands in a fraying piece of rope.

Although non-complementary sequences are also possible in the middle of double stranded DNA, mismatched regions away from the ends are not referred to as "frayed".

==Discovery==

[[Ronald W. Davis]] first discovered sticky ends as the product of the action of [[EcoRI]], the restriction [[endonuclease]].<ref>[http://www.gruberprizes.org/PressReleases/PressRelease_2011_Genetics.php The Gruber Foundation Homepage | The Gruber Foundation<!-- Bot generated title -->] ((Webarchive|url=https://web.archive.org/web/20120511044055/http://www.gruberprizes.org/PressReleases/PressRelease_2011_Genetics.php |date=2012-05-11 ))</ref>

==Strength==

Sticky end links are different in their stability. Free energy of formation can be measured to estimate stability. Free energy approximations can be made for different sequences from data related to oligonucleotide UV thermal denaturation curves.<ref>((cite journal|author=John SantaLucia Jr. |title=A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics |journal=Proceedings of the National Academy of Sciences of the USA |pages=1460–1465 |year=1997 |volume=95|issue=4|pmid=9465037 |doi=10.1073/pnas.95.4.1460 |pmc=19045|doi-access=free ))</ref> Also predictions from molecular dynamics simulations show that some sticky end links are much stronger in stretch than the others.<ref>((cite journal|author=Ehsan Ban and Catalin R Picu |title=Strength of DNA Sticky End Links |journal=Biomacromolecules |pages=143–149 |year=2014 |volume=15|issue=1|pmid=24328228 | doi=10.1021/bm401425k ))</ref>

==References==
((Wikidata property|P4914))
* [[Sambrook, Joseph]]; David Russell (2001). ''Molecular Cloning: A Laboratory Manual.'' New York: [[Cold Spring Harbor Laboratory Press]], ((ISBN|0879695765)).
((Reflist))

[[Category:DNA]]
[[Category:Genetics techniques]]
[[Category:Molecular biology]]

Pages transcluded onto the current version of this page (help):

Sticky and blunt ends (edit)
Template:Ambox (view source) (template editor protected)
Template:Catalog lookup link (view source) (template editor protected)
Template:Cite book (view source) (protected)
Template:Cite journal (view source) (protected)
Template:Find sources mainspace (view source) (template editor protected)
Template:ISBN (view source) (template editor protected)
Template:Main other (view source) (protected)
Template:More citations needed (view source) (template editor protected)
Template:Pagetype (view source) (protected)
Template:Plainlist/styles.css (view source) (protected)
Template:Reflist (view source) (protected)
Template:Reflist/styles.css (view source) (protected)
Template:SDcat (view source) (protected)
Template:Short description (view source) (protected)
Template:Short description/lowercasecheck (view source) (protected)
Template:Side box (view source) (template editor protected)
Template:Sister project (view source) (template editor protected)
Template:Webarchive (view source) (template editor protected)
Template:Wikidata property (view source) (semi-protected)
Template:Yesno (view source) (protected)
Template:Yesno-no (view source) (template editor protected)
Template:Yesno-yes (view source) (template editor protected)
Module:Arguments (view source) (protected)
Module:Catalog lookup link (view source) (template editor protected)
Module:Category handler (view source) (protected)
Module:Category handler/blacklist (view source) (protected)
Module:Category handler/config (view source) (protected)
Module:Category handler/data (view source) (protected)
Module:Category handler/shared (view source) (protected)
Module:Check for unknown parameters (view source) (protected)
Module:Check isxn (view source) (template editor protected)
Module:Citation/CS1 (view source) (protected)
Module:Citation/CS1/COinS (view source) (protected)
Module:Citation/CS1/Configuration (view source) (protected)
Module:Citation/CS1/Date validation (view source) (protected)
Module:Citation/CS1/Identifiers (view source) (protected)
Module:Citation/CS1/Utilities (view source) (protected)
Module:Citation/CS1/Whitelist (view source) (protected)
Module:Citation/CS1/styles.css (view source) (protected)
Module:Disambiguation/templates (view source) (protected)
Module:Find sources (view source) (template editor protected)
Module:Find sources/config (view source) (template editor protected)
Module:Find sources/links (view source) (template editor protected)
Module:Find sources/templates/Find sources mainspace (view source) (template editor protected)
Module:Message box (view source) (protected)
Module:Message box/ambox.css (view source) (protected)
Module:Message box/configuration (view source) (protected)
Module:Namespace detect/config (view source) (protected)
Module:Namespace detect/data (view source) (protected)
Module:Pagetype (view source) (protected)
Module:Pagetype/config (view source) (protected)
Module:Pagetype/disambiguation (view source) (protected)
Module:Pagetype/setindex (view source) (protected)
Module:Pagetype/softredirect (view source) (protected)
Module:SDcat (view source) (protected)
Module:Side box (view source) (template editor protected)
Module:Side box/styles.css (view source) (template editor protected)
Module:String (view source) (protected)
Module:Unsubst (view source) (protected)
Module:Uses Wikidata (view source) (extended confirmed protected)
Module:Webarchive (view source) (template editor protected)
Module:Webarchive/data (view source) (template editor protected)
Module:Wikitext Parsing (view source) (protected)
Module:Yesno (view source) (protected)

Return to Sticky and blunt ends.

Retrieved from "https://en.wikipedia.org/wiki/Sticky_and_blunt_ends"